pabai vector (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
98
Structured Review
TaKaRa
pabai vector
Pabai Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pabai+vector/Matchmaker+Gold+Yeast+One-Hybrid+Library+Screening+System/pm41416468-260-30-32
Average 98 stars, based on 1231 article reviews
Pabai Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pabai+vector/Matchmaker+Gold+Yeast+One-Hybrid+Library+Screening+System/pm41416468-260-30-32
Average 98 stars, based on 1231 article reviews
pabai vector - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Sequencing:Article Title: SlWRKY37 targets SlLEA2 and SlABI5-like7 to regulate seed germination vigor in tomato. Article Snippet: Seed germination is a critical phase for the life cycle and propagation of higher plants.. This study explores the role of SlWRKY37, a WRKY transcription factor in tomato, in modulating seed germination.. We discovered that SlWRKY37 expression is markedly downregulated during tomato seed germination. Article Title: Ethylene-induced MdDof1.2 activates MdAMY1 to promote starch degradation in post-harvest apple fruit Article Snippet: Starch degradation is a critical physiological change that occurs during the postharvest storage of apples, significantly affecting fruit quality.. Ethylene, a key hormone in climacteric fruits, is known to promote this process.. However, the underlying mechanism remains poorly understood. Article Title: A MYB ‐related transcription factor regulates effector gene expression in an oomycete pathogen Article Snippet: .. The bait DNA sequence (5′‐TACATGTACACACATACATGTACACACATACATGTACACACATACATGTA‐3′) was cloned into the Clone Assay:Article Title: SlWRKY37 targets SlLEA2 and SlABI5-like7 to regulate seed germination vigor in tomato. Article Snippet: Seed germination is a critical phase for the life cycle and propagation of higher plants.. This study explores the role of SlWRKY37, a WRKY transcription factor in tomato, in modulating seed germination.. We discovered that SlWRKY37 expression is markedly downregulated during tomato seed germination. Article Title: Ethylene-induced MdDof1.2 activates MdAMY1 to promote starch degradation in post-harvest apple fruit Article Snippet: Starch degradation is a critical physiological change that occurs during the postharvest storage of apples, significantly affecting fruit quality.. Ethylene, a key hormone in climacteric fruits, is known to promote this process.. However, the underlying mechanism remains poorly understood. Article Title: A MYB ‐related transcription factor regulates effector gene expression in an oomycete pathogen Article Snippet: .. The bait DNA sequence (5′‐TACATGTACACACATACATGTACACACATACATGTACACACATACATGTA‐3′) was cloned into the Article Title: CaLAP1 and CaLAP2 orchestrate anthocyanin biosynthesis in the seed coat of Cicer arietinum. Article Snippet: Main conclusion Our findings shed light on the regulation of anthocyanin and proanthocyanidin biosynthesis in chickpea seed coats.. Expression of R2R3-MYB transcription factors CaLAP1 and CaLAP2 enhanced the anthocyanins and proanthocyanidins content in chickpea.. Abstract The seed coat color is a major economic trait in leguminous crop chickpea (Cicer arietinum). Article Title: Histone deacetylase MdHDT3 suppresses ethylene biosynthesis by deacetylating MdACS1 and MdACO1 during apple fruit ripening Article Snippet: Apple (Malus domestica) is a climacteric fruit whose ripening is primarily controlled by ethylene.. Histone acetylation functions in ethylene biosynthesis during apple ripening, but its underlying molecular mechanisms in ethylene biosynthesis are unclear.. Therefore, this study aims to investigate the effects and potential molecular mechanisms of histone modifications in ethylene synthesis during apple fruit ripening. Plasmid Preparation:Article Title: SlWRKY37 targets SlLEA2 and SlABI5-like7 to regulate seed germination vigor in tomato. Article Snippet: Seed germination is a critical phase for the life cycle and propagation of higher plants.. This study explores the role of SlWRKY37, a WRKY transcription factor in tomato, in modulating seed germination.. We discovered that SlWRKY37 expression is markedly downregulated during tomato seed germination. Article Title: Ethylene-induced MdDof1.2 activates MdAMY1 to promote starch degradation in post-harvest apple fruit Article Snippet: Starch degradation is a critical physiological change that occurs during the postharvest storage of apples, significantly affecting fruit quality.. Ethylene, a key hormone in climacteric fruits, is known to promote this process.. However, the underlying mechanism remains poorly understood. Article Title: Ethylene promotes branch formation but inhibits tendril development in cucumber Article Snippet: Electrophoretic mobility shift assays were then performed using a chemiluminescent EMSA kit (Beyotime Biotechnology, China) according to the manufacturer’s instructions. .. Primers were designed for the four binding sites of CsEIN3 in CsCYP707A4 promoter (p1-p4) and p1 in CsTL promoter, and to obtain PCR fragments, which were then inserted into the Article Title: A MYB ‐related transcription factor regulates effector gene expression in an oomycete pathogen Article Snippet: .. The bait DNA sequence (5′‐TACATGTACACACATACATGTACACACATACATGTACACACATACATGTA‐3′) was cloned into the Article Title: TaPHL7 Transcription Factor Regulates Utilisation of Nitrogen and Phosphorus in Wheat. Article Snippet: .. Briefly, to construct a bait reporter of pTaGS1;3p::AUR1- C used in the Y1H assay, a 2000- bp fragment of the TaGS1;3–4D promoter was inserted into the SalI/SacI sites of a Article Title: Ethylene promotes branch formation but inhibits tendril development in cucumber. Article Snippet: .. Primers were designed for the four binding sites of CsEIN3 in CsCYP707A4 promoter (p1-p4) and p1 in CsTL promoter and to obtain PCR fragments, which were then inserted into the Y1H Assay:Article Title: Ethylene-induced MdDof1.2 activates MdAMY1 to promote starch degradation in post-harvest apple fruit Article Snippet: Starch degradation is a critical physiological change that occurs during the postharvest storage of apples, significantly affecting fruit quality.. Ethylene, a key hormone in climacteric fruits, is known to promote this process.. However, the underlying mechanism remains poorly understood. Article Title: TaPHL7 Transcription Factor Regulates Utilisation of Nitrogen and Phosphorus in Wheat. Article Snippet: .. Briefly, to construct a bait reporter of pTaGS1;3p::AUR1- C used in the Y1H assay, a 2000- bp fragment of the TaGS1;3–4D promoter was inserted into the SalI/SacI sites of a Construct:Article Title: Ethylene-induced MdDof1.2 activates MdAMY1 to promote starch degradation in post-harvest apple fruit Article Snippet: Starch degradation is a critical physiological change that occurs during the postharvest storage of apples, significantly affecting fruit quality.. Ethylene, a key hormone in climacteric fruits, is known to promote this process.. However, the underlying mechanism remains poorly understood. Article Title: TaPHL7 Transcription Factor Regulates Utilisation of Nitrogen and Phosphorus in Wheat. Article Snippet: .. Briefly, to construct a bait reporter of pTaGS1;3p::AUR1- C used in the Y1H assay, a 2000- bp fragment of the TaGS1;3–4D promoter was inserted into the SalI/SacI sites of a Binding Assay:Article Title: Ethylene promotes branch formation but inhibits tendril development in cucumber Article Snippet: Electrophoretic mobility shift assays were then performed using a chemiluminescent EMSA kit (Beyotime Biotechnology, China) according to the manufacturer’s instructions. .. Primers were designed for the four binding sites of CsEIN3 in CsCYP707A4 promoter (p1-p4) and p1 in CsTL promoter, and to obtain PCR fragments, which were then inserted into the Article Title: Ethylene promotes branch formation but inhibits tendril development in cucumber. Article Snippet: .. Primers were designed for the four binding sites of CsEIN3 in CsCYP707A4 promoter (p1-p4) and p1 in CsTL promoter and to obtain PCR fragments, which were then inserted into the Polymerase Chain Reaction:Article Title: Ethylene promotes branch formation but inhibits tendril development in cucumber Article Snippet: Electrophoretic mobility shift assays were then performed using a chemiluminescent EMSA kit (Beyotime Biotechnology, China) according to the manufacturer’s instructions. .. Primers were designed for the four binding sites of CsEIN3 in CsCYP707A4 promoter (p1-p4) and p1 in CsTL promoter, and to obtain PCR fragments, which were then inserted into the Article Title: Ethylene promotes branch formation but inhibits tendril development in cucumber. Article Snippet: .. Primers were designed for the four binding sites of CsEIN3 in CsCYP707A4 promoter (p1-p4) and p1 in CsTL promoter and to obtain PCR fragments, which were then inserted into the |